circad | circRNAs associated with diseases

hsa_circRNA_104423
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28206972
Experimental Method
Sample Type	Cancer Tissues	Comparison	125 patients diagnosed with stage III gastric cancer
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCACTGGCAAAGAGTCACCTAAA Reverse ATTCCCTGGCAGTTCCGTGTA	Statistics	Fold Change : Downregulated 3.5205997 pvalue : p=0.003324673
Citation
Zhang, Y, Li, J, Yu, J, Liu, H, Shen, Z, Ye, G, Mou, T, Qi, X, Li, G (2017). Circular RNAs signature predicts the early recurrence of stage III gastric cancer after radical surgery. Oncotarget, 8, 14:22936-22943.